Specimen Jan 25, 2022
Aphelenchus avenae
AustraliaNew South WalesNarromine
Sequenced
Record
- Dataset
- Australian Microbiome 18S (Eukaryote) Dataset of Terrestrial Samples
- Basis of record
- Material sample
Taxon
- Scientific name
- Aphelenchus avenae
- Taxon ID
- ASV:094c05fb6139b792ef9aefda0415a023
- Kingdom
- Animalia
- Phylum
- Nematoda
- Class
- Chromadorea
- Order
- Rhabditida
- Family
- Aphelenchidae
- Genus
- Aphelenchus
Aphelenchus avenae Bastian, 1865
KingdomAnimaliaPhylumNematodaClassChromadoreaOrderRhabditidaFamilyAphelenchidaeGenusAphelenchusSpeciesAphelenchus avenae
- Taxon ID not found
Aphelenchus avenae Bastian, 1865
DomainEukaryotaKingdomAnimaliaPhylumNematodaClassChromadoreaSubclassChromadoriaOrderRhabditidaSuborderTylenchinaInfraorderTylenchomorphaSuperfamilyAphelenchoideaFamilyAphelenchidaeGenusAphelenchusSpeciesAphelenchus avenae
- Taxon ID not found
Location
- Continent
- OceaniaInferred
- Country or area
- AustraliaCountry derived from coordinatesInferred
- Decimal latitude
- -31.973Country derived from coordinates
- Decimal longitude
- 148.037Country derived from coordinates
- Geodetic datum
- WGS84Country derived from coordinatesGeodetic datum assumed WGS84Inferred
- Location according to GADM
- AustraliaNew South WalesNarromine
Loading map...
Occurrence
- Occurrence ID
- 102.100.100/401664:094c05fb6139b792ef9aefda0415a023
- Recorded by
- Jeff Powell
- Organism quantity
- 1
- Organism quantity type
- DNA sequence reads
- Sex
- Occurrence status
- PresentInferred
Other
- Record licence
- CC0 1.0Inferred
- Identifier
- 102.100.100/401664:094c05fb6139b792ef9aefda0415a023
- GBIF ID
- 5230745874
DNA derived data
- 0000014
- Soil [ENVO_00001998]
- 0000045
- V9
- 0000012
- 1 Conservation and Natural Environments
- 0000013
- 1.3.3 Residual native cover
- 0000087
- PR2;version_5.0.0_SSU_UTAX|GBIF backbone;2023-08-28
- 0000044
- 18S
- 0000085
- blast+;2.16.0;qcov_hsp_perc 50;perc_identity 70;word_size 7;max_target_seqs 1;Only ZOTUs classifying to target kingdom/domain retained;GBIF_Backbone (2023-08-28) used to assign taxonomy, if scientificName matches at taxonomic levels species to phylum
- 0000041
- Paired
- 0000086
- blast+;2.16.0;qcov_hsp_perc 50;perc_identity 70;word_size 7;max_target_seqs 1
- 0000090
- https://research.csiro.au/ambsm/5-bioinformatics/meth_5-1-amplicon-analysis/
- pcr_primer_name_reverse
- EukB
- 0000091
- https://data.bioplatforms.com//organization/australian-microbiome?q=sample_id:102.100.100/401664
- pcr_primer_forward
- Non-indexed: GTACACACCGCCCGTC | indexed:GTACACACCGCCCGTCG
- pcr_primer_name_forward
- 1391F
- pcr_primer_reference
- Stoeck T, Bass D, Nebel M, Christen R, Jones MD, Breiner HW, Richards TA. Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Mol Ecol. 2010 Mar;19 Suppl 1:21-31. doi: 10.1111/j.1365-294X.2009.04480.x. PMID: 20331767| EukB: Medlin LK, Elwood HJ, Stickel S, Sogin ML (1988) The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene, 71, 491–499.
- pcr_primer_reverse
- TGATCCTTCTGCAGGTTCACCTAC
- dna_sequence
- GCTGCCCGGGACTGAGCCATTTCGAGAAAATCGGGGATTGCTGATTTCTGTTCTTTCGGGAACAGGCTTTGGCGAAAACCGATTTAATCGCAGTGGCTTGAACCGGGCAAAAGTCGTAACAAGGTAGCT
- 0000028
- Free-living
Extended measurement or fact
109 rows
- Measurement type
- depth_lower
- Whether the record has geospatial issues.
- 0.1
- Measurement unit
- meter
- Measurement type
- depth_upper
- Whether the record has geospatial issues.
- 0
- Measurement unit
- meter
- Measurement type
- depth
- Whether the record has geospatial issues.
- 0
- Measurement unit
- meter
- Measurement type
- dna_concentration_submitter
- Measurement method
- dna_concentration_submitter_meth
- Measurement unit
- nanogram per microliter
- Measurement type
- dna_concentration_submitter_meth
- Measurement type
- ammonium_nitrogen_wt
- Whether the record has geospatial issues.
- 10
- Measurement method
- ammonium_nitrogen_wt_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- ammonium_nitrogen_wt_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- arsenic
- Measurement method
- arsenic_meth
- Measurement unit
- microgram per kilogram
- Measurement type
- arsenic_meth
- Measurement type
- boron_hot_cacl2
- Whether the record has geospatial issues.
- 1.1
- Measurement method
- boron_hot_cacl2_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- boron_hot_cacl2_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- cadmium
- Measurement method
- cadmium_meth
- Measurement unit
- microgram per kilogram
- Measurement type
- cadmium_meth
- Measurement type
- chromium
- Measurement method
- chromium_meth
- Measurement unit
- microgram per kilogram
- Measurement type
- chromium_meth
- Measurement type
- clay
- Whether the record has geospatial issues.
- 28.82
- Measurement method
- clay_meth
- Measurement unit
- percent
- Measurement type
- clay_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- cobalt
- Measurement method
- cobalt_meth
- Measurement unit
- microgram per kilogram
- Measurement type
- cobalt_meth
- Measurement type
- color
- Whether the record has geospatial issues.
- DKBR
- Measurement method
- color_meth
- Measurement type
- color_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- conductivity
- Whether the record has geospatial issues.
- 0.074
- Measurement method
- conductivity_meth
- Measurement unit
- decisiemens per meter
- Measurement type
- conductivity_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- coarse_sand
- Measurement method
- coarse_sand_meth
- Measurement unit
- percent
- Measurement type
- coarse_sand_meth
- Measurement type
- days_since_planting
- Measurement unit
- days
- Measurement type
- density
- Measurement method
- density_meth
- Measurement unit
- kilogram per cubic meter
- Measurement type
- density_meth
- Measurement type
- dtpa_copper
- Whether the record has geospatial issues.
- 0.56
- Measurement method
- dtpa_copper_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- dtpa_copper_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- dtpa_iron
- Whether the record has geospatial issues.
- 16.3
- Measurement method
- dtpa_iron_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- dtpa_iron_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- dtpa_manganese
- Whether the record has geospatial issues.
- 41.71
- Measurement method
- dtpa_manganese_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- dtpa_manganese_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- dtpa_zinc
- Whether the record has geospatial issues.
- 0.65
- Measurement method
- dtpa_zinc_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- dtpa_zinc_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- elev
- Measurement unit
- meter
- Measurement type
- exc_aluminium
- Whether the record has geospatial issues.
- 0.03
- Measurement method
- exc_aluminium_meth
- Measurement unit
- milliequivalents per 100 grams
- Measurement type
- exc_aluminium_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- exc_calcium
- Whether the record has geospatial issues.
- 9.43
- Measurement method
- exc_calcium_meth
- Measurement unit
- milliequivalents per 100 grams
- Measurement type
- exc_calcium_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- exc_magnesium
- Whether the record has geospatial issues.
- 1.63
- Measurement method
- exc_magnesium_meth
- Measurement unit
- milliequivalents per 100 grams
- Measurement type
- exc_magnesium_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- exc_potassium
- Whether the record has geospatial issues.
- 1.31
- Measurement method
- exc_potassium_meth
- Measurement unit
- milliequivalents per 100 grams
- Measurement type
- exc_potassium_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- exc_sodium
- Whether the record has geospatial issues.
- 0.02
- Measurement method
- exc_sodium_meth
- Measurement unit
- milliequivalents per 100 grams
- Measurement type
- exc_sodium_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- fine_sand
- Measurement method
- fine_sand_meth
- Measurement unit
- percent
- Measurement type
- fine_sand_meth
- Measurement type
- fresh_weight
- Measurement method
- fresh_weight_meth
- Measurement unit
- gram
- Measurement type
- fresh_weight_meth
- Measurement type
- gravel
- Whether the record has geospatial issues.
- 0
- Measurement method
- gravel_meth
- Measurement unit
- percent
- Measurement type
- gravel_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- hyperspectral_analysis
- Measurement method
- hyperspectral_analysis_meth
- Measurement type
- hyperspectral_analysis_meth
- Measurement type
- lead
- Measurement method
- lead_meth
- Measurement unit
- microgram per kilogram
- Measurement type
- lead_meth
- Measurement type
- local_class
- Whether the record has geospatial issues.
- Sodosol
- Measurement method
- local_class_meth
- Measurement type
- local_class_meth
- Whether the record has geospatial issues.
- meth_2.27 (https://research.csiro.au/ambsm/)
- Measurement type
- microbial_biomass
- Measurement method
- microbial_biomass_meth
- Measurement type
- microbial_biomass_meth
- Measurement type
- molybdenum
- Measurement method
- molybdenum_meth
- Measurement unit
- microgram per kilogram
- Measurement type
- molybdenum_meth
- Measurement type
- nitrate_nitrogen
- Whether the record has geospatial issues.
- 7
- Measurement method
- nitrate_nitrogen_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- nitrate_nitrogen_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- organic_carbon
- Whether the record has geospatial issues.
- 1.25
- Measurement method
- organic_carbon_meth
- Measurement unit
- percent
- Measurement type
- organic_carbon_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- ph
- Whether the record has geospatial issues.
- 6
- Measurement method
- ph_meth
- Measurement type
- ph_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- ph_solid_h2o
- Whether the record has geospatial issues.
- 6.6
- Measurement method
- ph_solid_h2o_meth
- Measurement type
- ph_solid_h2o_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- phosphorus_colwell
- Whether the record has geospatial issues.
- 14
- Measurement method
- phosphorus_colwell_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- phosphorus_colwell_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- plant_stage
- Measurement method
- plant_stage_meth
- Measurement type
- plant_stage_meth
- Measurement type
- potassium_colwell
- Whether the record has geospatial issues.
- 599
- Measurement method
- potassium_colwell_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- potassium_colwell_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- root_length
- Measurement method
- root_length_meth
- Measurement unit
- centimeter
- Measurement type
- root_length_meth
- Measurement type
- sand
- Whether the record has geospatial issues.
- 58.8
- Measurement method
- sand_meth
- Measurement unit
- percent
- Measurement type
- sand_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- selenium
- Measurement method
- selenium_meth
- Measurement unit
- microgram per kilogram
- Measurement type
- selenium_meth
- Measurement type
- shoot_length
- Measurement method
- shoot_length_meth
- Measurement unit
- centimeter
- Measurement type
- shoot_length_meth
- Measurement type
- silt
- Whether the record has geospatial issues.
- 12.38
- Measurement method
- silt_meth
- Measurement unit
- percent
- Measurement type
- silt_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- slope_aspect
- Measurement method
- slope_aspect_meth
- Measurement unit
- direction or degrees
- Measurement type
- slope_aspect_meth
- Measurement type
- slope_gradient
- Measurement method
- slope_gradient_meth
- Measurement unit
- percent
- Measurement type
- slope_gradient_meth
- Measurement type
- sulphur
- Whether the record has geospatial issues.
- 3.3
- Measurement method
- sulphur_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- sulphur_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- temp
- Measurement method
- temp_meth
- Measurement unit
- degree celsius
- Measurement type
- temp_meth
- Measurement type
- texture
- Whether the record has geospatial issues.
- 2.5
- Measurement method
- texture_meth
- Measurement type
- texture_meth
- Whether the record has geospatial issues.
- meth_2.1 (https://research.csiro.au/ambsm/)
- Measurement type
- total_nitrogen
- Measurement method
- total_nitrogen_meth
- Measurement unit
- milligram per kilogram
- Measurement type
- total_nitrogen_meth
- Measurement type
- vegetation_dom_grasses
- Measurement method
- vegetation_dom_grasses_meth
- Measurement unit
- percent
- Measurement type
- vegetation_dom_grasses_meth
- Measurement type
- vegetation_dom_shrubs
- Measurement method
- vegetation_dom_shrubs_meth
- Measurement unit
- percent
- Measurement type
- vegetation_dom_shrubs_meth
- Measurement type
- vegetation_dom_trees
- Measurement method
- vegetation_dom_trees_meth
- Measurement unit
- percent
- Measurement type
- vegetation_dom_trees_meth
- Measurement type
- vegetation_total_cover
- Measurement method
- vegetation_total_cover_meth
- Measurement unit
- percent
- Measurement type
- vegetation_total_cover_meth
- Measurement type
- water_content
- Measurement method
- water_content_soil_meth
- Measurement unit
- percent
- Measurement type
- water_content_soil_meth
Citation
- Please use this citation in publications
- Australian Microbiome (2025). Australian Microbiome 18S (Eukaryote) Dataset of Terrestrial Samples. GBIF Metabarcoding Test organisation. Occurrence dataset https://doi.org/10.21373/rwqr9f accessed via GBIF.org on 2025-07-18. https://gbif.org/occurrence/5230745874
- API access
- Dataset
- Australian Microbiome 18S (Eukaryote) Dataset of Terrestrial Samples
- Publisher
- GBIF Metabarcoding Test organisation
- Last crawled
- 2025-07-14T10:18:12.049